Top » Catalog » SNPs » A17514

$18.00

A17514
[A17514]

A17514
hg38 Position: ChrY:16839773..16839773
Ancestral: C
Derived: A
Reference: Connie McKenzie (2017)
ISOGG Haplogroup: R1b
Comments: Below A824 > A5860
Forward Primer: A17514_F AGAGCATCCTGGCTAACACG
Reverse Primer: A17514_R GCTGAAGCCTTTTGGTGAAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
A17510
A17510
A17513
A17513
A17512
A17512
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies