Top » Catalog » SNPs » FGC23207

$18.00

FGC23207
[FGC23207]

FGC23207
hg38 Position: ChrY:9034714..9034714
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC23207_F GGGATTACAGGCATGAGCC
Reverse Primer: FGC23207_R GTTTTGTTATACTTCTACCAAGTTAGTTTATACATG
Reviews

Customers who bought this product also purchased
FGC23227
FGC23227
DYS617
DYS617
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies