Top » Catalog » SNPs » Z44223

$19.00

Z44223
[Z44223]

Z44223
hg38 Position: ChrY:16068960..16068960
Ancestral: C
Derived: T
Reference: Ray Banks (2017)
ISOGG Haplogroup: G2a2b2a1a1a2a1
Comments: Below L1264. Aka Y32607.
Forward Primer: Z44223_F TATGGCTCACCCAATTCTGC
Reverse Primer: Z44223_R TGAAGACATGTGGAACCCAAC
Reviews

Customers who bought this product also purchased
FGC59713
FGC59713
FGC21495
FGC21495
Y32599
Y32599
L1264
L1264
Y87501
Y87501
Z6759
Z6759
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies