Top » Catalog » SNPs » Z44223

$18.00

Z44223
[Z44223]

Z44223
hg38 Position: ChrY:16068960..16068960
Ancestral: C
Derived: T
Reference: Ray Banks (2017)
ISOGG Haplogroup: G2a2b2a1a1a2a1
Comments: Below L1264. Aka Y32607.
Forward Primer: Z44223_F TATGGCTCACCCAATTCTGC
Reverse Primer: Z44223_R TGAAGACATGTGGAACCCAAC
Reviews

Customers who bought this product also purchased
Z6759
Z6759
Y107131
Y107131
U1
U1
Y32597
Y32597
Y169201
Y169201
G2a-L1259 Panel
G2a-L1259 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies