Top » Catalog » SNPs » CTS595

$18.00

CTS595
[CTS595]

CTS595
hg38 Position: ChrY:7006074..7006074
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1a
Comments: Below P37.2
Forward Primer: CTS595_F TTTTTGGACAAGGTTTGTACCC
Reverse Primer: CTS595_R TTCCCAATTTCCTACAAAAACAG
Reviews

Customers who bought this product also purchased
M304
M304
A12505
A12505
L596
L596
Y5596
Y5596
P38
P38
A21222
A21222
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies