Top » Catalog » SNPs » CTS595

$18.00

CTS595
[CTS595]

CTS595
hg38 Position: ChrY:7006074..7006074
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1a
Comments: Below P37.2
Forward Primer: CTS595_F TTTTTGGACAAGGTTTGTACCC
Reverse Primer: CTS595_R TTCCCAATTTCCTACAAAAACAG
Reviews

Customers who bought this product also purchased
A19385
A19385
I2 Superclade Panel
I2 Superclade Panel
M168
M168
A10230
A10230
M253
M253
A7358
A7358
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies