Top » Catalog » SNPs » CTS595

$18.00

CTS595
[CTS595]

CTS595
hg38 Position: ChrY:7006074..7006074
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1a
Comments: Below P37.2
Forward Primer: CTS595_F TTTTTGGACAAGGTTTGTACCC
Reverse Primer: CTS595_R TTCCCAATTTCCTACAAAAACAG
Reviews

Customers who bought this product also purchased
Y33761
Y33761
Y4200
Y4200
L233
L233
A8462
A8462
I2a-CTS595 Panel
I2a-CTS595 Panel
FGC56815
FGC56815
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies