Top » Catalog » SNPs » CTS595

$18.00

CTS595
[CTS595]

CTS595
hg38 Position: ChrY:7006074..7006074
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1a
Comments: Below P37.2
Forward Primer: CTS595_F TTTTTGGACAAGGTTTGTACCC
Reverse Primer: CTS595_R TTCCCAATTTCCTACAAAAACAG
Reviews

Customers who bought this product also purchased
A19384
A19384
A19485
A19485
A14893
A14893
A16520
A16520
F25958
F25958
A19300
A19300
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies