Top » Catalog » SNPs » CTS595

$18.00

CTS595
[CTS595]

CTS595
hg38 Position: ChrY:7006074..7006074
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I2a1a
Comments: Below P37.2
Forward Primer: CTS595_F TTTTTGGACAAGGTTTGTACCC
Reverse Primer: CTS595_R TTCCCAATTTCCTACAAAAACAG
Reviews

Customers who bought this product also purchased
F3145
F3145
Y99608
Y99608
A5913
A5913
FT138628
FT138628
PF4609
PF4609
Y51673
Y51673
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies