Top » Catalog » SNPs » A1818

$18.00

A1818
[A1818]

A1818
hg38 Position: ChrY:13602573..13602573
Ancestral: G
Derived: A
Reference: William Hartley (2015)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: DownstreamZ140+ Z2535+ S12289+ [02] Branch
Forward Primer: A1818_F TTCTGGGCTAGGAATCTTGG
Reverse Primer: A1818_R ATTTGTGAGGGAAGCACCAG
Reviews

Customers who bought this product also purchased
A427
A427
S10309
S10309
S25733
S25733
Y4893
Y4893
I2a-CTS10100 Panel
I2a-CTS10100 Panel
Y5367
Y5367
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies