Top » Catalog » SNPs » A17594

$18.00

A17594
[A17594]

A17594
hg38 Position: ChrY:20047139..20047139
Ancestral: C
Derived: A
Reference: Alex Williamson (2017)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > DF105 > S603
Forward Primer: A17594_F AAAAAATTAGCCGGGCAGA
Reverse Primer: A17594_R TTGACCAATACACAAATGATCTCC
Reviews

Customers who bought this product also purchased
S7814
S7814
FGC23592
FGC23592
FGC16741
FGC16741
FGC19831
FGC19831
FGC10147
FGC10147
A10629
A10629
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies