Top » Catalog » SNPs » A17594

$18.00

A17594
[A17594]

A17594
hg38 Position: ChrY:20047139..20047139
Ancestral: C
Derived: A
Reference: Alex Williamson (2017)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > DF105 > S603
Forward Primer: A17594_F AAAAAATTAGCCGGGCAGA
Reverse Primer: A17594_R TTGACCAATACACAAATGATCTCC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies