Top » Catalog » SNPs » FGC65810

$18.00

FGC65810
[FGC65810]

FGC65810
hg38 Position: ChrY:7417731..7417731
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11134>A9871
Forward Primer: FGC65810_F AAATATAACAGGGAAAACAGTGTCC
Reverse Primer: FGC65810_R TTCGAAGTAGGGAAAATGCAG
Reviews

Customers who bought this product also purchased
FGC11293
FGC11293
DF49
DF49
Z255
Z255
A9871
A9871
DF13
DF13
FGC11134
FGC11134
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies