Top » Catalog » SNPs » A17618

$18.00

A17618
[A17618]

A17618
hg38 Position: ChrY:7213143..7213143
Ancestral: A
Derived: G
Reference: Linda Jonas (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11134 >A9871
Forward Primer: A17618_F AGGATCGCTTGAGTTGATGC
Reverse Primer: A17618_R TAGCTTGAACCTGGGAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies