Top » Catalog » SNPs » Y30121

$18.00

Y30121
[Y30121]

Y30121
hg38 Position: ChrY:20697966..20697966
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: N1a2b2a1* (not listed)
Comments: Below FGC38830.
Forward Primer: Y30121_F AACCTGCTCACACCTCCATC
Reverse Primer: Y30121_R AAAGTTGAGAGCCCGGGTAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies