Top » Catalog » SNPs » Y10933

$18.00

Y10933
[Y10933]

Y10933
hg38 Position: ChrY:21242431..21242431
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: N1a1a1a1a1a1a7a3a~
Comments: Below Y4340.
Forward Primer: Y10933_F TGAGGTTTGGCTAGCATTCTG
Reverse Primer: Y10933_R GGCACATTTGGGTACCTGTG
Reviews

Customers who bought this product also purchased
Y4338
Y4338
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies