Top » Catalog » SNPs » Y22774

$18.00

Y22774
[Y22774]

Y22774
hg38 Position: ChrY:12048892..12048892
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: N1a1a1a1a1a1a7a2a~
Comments: Below Y19111.
Forward Primer: Y22774_F AGCAGCCGGACTGAACTC
Reverse Primer: Y22774_R CAGACCAGCTGGCATTAGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies