Top » Catalog » SNPs » Y24222

$18.00

Y24222
[Y24222]

Y24222
HG19 Position: ChrY:7685138..7685138
Ancestral: C
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: N1a1a1a1a2a1c1a1~
Comments: Below L1442.
Forward Primer: Y24222_F ATGCTTCCTCTTGGCAGAAC
Reverse Primer: Y24222_R TCGACCCAACTCATAGAGAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies