Top » Catalog » SNPs » Y28775

$18.00

Y28775
[Y28775]

Y28775
HG19 Position: ChrY:14328860..14328860
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: N1a1a1a1a1a1a5b~
Comments: Below Y7795.
Forward Primer: Y28775_F ACCCCAACCTCTGCTTCC
Reverse Primer: Y28775_R GGCATCTGAAGACTTTGATTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies