Top » Catalog » SNPs » CLD91

$18.00

CLD91
[CLD91]

CLD91
hg38 Position: ChrY:13566491..13566491
Ancestral: A
Derived: G
Reference: Doug McDonald (2017)
ISOGG Haplogroup: R1a
Comments: Below CTS4179 > YP280
Forward Primer: CLD91_F TTTTGCAAATAGCCGTGTCC
Reverse Primer: CLD91_R TTGGGCTTGCTAAGATTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies