Top » Catalog » SNPs » CLD92

$18.00

CLD92
[CLD92]

CLD92
HG19 Position: ChrY:19546751..19546751
Ancestral: A
Derived: T
Reference: Doug McDonald (2017)
ISOGG Haplogroup: R1a
Comments: Below CTS4179 > YP280
Forward Primer: CLD92_F ATCTATCTATATCTCTCCATGCTAGTGAGATG
Reverse Primer: CLD92_R TTAAGCACACCTCAGGCTTTAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies