Top » Catalog » SNPs » FGC8407

$18.00

FGC8407
[FGC8407]

FGC8407
HG19 Position: ChrY:23637251..23637251
Ancestral: G
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: unknown
Comments: .
Forward Primer: FGC8407_F CTCACCAGAAATGAGGTGGTC
Reverse Primer: FGC8407_R GACTTCAAGAGCAAAGTAAACACTATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies