Top » Catalog » SNPs » YP6398

$18.00

YP6398
[YP6398]

YP6398
HG19 Position: ChrY:17716141..17716141
Ancestral: G
Derived: A
Reference: YDNA-community (2017)
ISOGG Haplogroup: R1a
Comments: Below CTS4179 > YP280
Forward Primer: YP6398_F CCCATGCAAGTCCAAAATTC
Reverse Primer: YP6398_R AGGCAGAGGTGTGATGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies