Top » Catalog » SNPs » BY14160

$18.00

BY14160
[BY14160]

BY14160
hg38 Position: ChrY:19700442..19700442
Ancestral: C
Derived: T
Reference: FTDNA (2017)
ISOGG Haplogroup: E1b
Comments: Below M35 > BY14151
Forward Primer: BY14160_F TGCAGCCTTCTGCAGTGTC
Reverse Primer: BY14160_R GACAGCTGAGACTGGAAAGTCC
Reviews

Customers who bought this product also purchased
PH2624
PH2624
S3003
S3003
BY34253
BY34253
Z5018
Z5018
BY14151
BY14151
Z5017
Z5017
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies