Top » Catalog » SNPs » Y31254

$18.00

Y31254
[Y31254]

Y31254
hg38 Position: ChrY:8791935..8791935
Ancestral: A
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: N1a1a1a1a2a1a1a1b1d1 (not listed)
Comments: Below BY549 > YP1138.
Forward Primer: Y31254_F GAACATCAATTTAACCACTCAGG
Reverse Primer: Y31254_R CCTCAAAATTCAAGCCACAATC
Reviews

Customers who bought this product also purchased
N1a-Z1936 Panel
N1a-Z1936 Panel
BY549
BY549
Z5893
Z5893
CTS3223
CTS3223
CTS4329
CTS4329
YP1138
YP1138
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies