Top » Catalog » SNPs » Y22261

$18.00

Y22261
[Y22261]

Y22261
hg38 Position: ChrY:13752540..13752540
Ancestral: C
Derived: T
Reference: YFull (2016)
ISOGG Haplogroup: N1a1a1a1a2a1a1a1b1b1f1~
Comments: Below Y17798
Forward Primer: Y22261_F CAAAGTCCCAGGTGCTCAG
Reverse Primer: Y22261_R TACTCGCCGGCTAAAAGAAC
Reviews

Customers who bought this product also purchased
Y20916
Y20916
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies