Top » Catalog » SNPs » A17692

$18.00

A17692
[A17692]

A17692
hg38 Position: ChrY:8538664..8538664
Ancestral: C
Derived: G
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11397/Rox2 Aka BY21586
Forward Primer: A17692_F AAGTTAAGCCTGGGGAAAGC
Reverse Primer: A17692_R ATACCTGAGCCCGGATTTTC
Reviews

Customers who bought this product also purchased
CTS11075
CTS11075
A16331
A16331
A16155
A16155
A16335
A16335
A16154
A16154
A16334
A16334
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies