Top » Catalog » SNPs » A17692

$18.00

A17692
[A17692]

A17692
hg38 Position: ChrY:8538664..8538664
Ancestral: C
Derived: G
Reference: Ed Aber Leek (2017)
ISOGG Haplogroup: R1b
Comments: Below FGC11397/Rox2 Aka BY21586
Forward Primer: A17692_F AAGTTAAGCCTGGGGAAAGC
Reverse Primer: A17692_R ATACCTGAGCCCGGATTTTC
Reviews

Customers who bought this product also purchased
CTS11075
CTS11075
A16155
A16155
A16335
A16335
A16154
A16154
A16334
A16334
R1b-FGC11397 Rox2 Dodds Segregation Panel
R1b-FGC11397 Rox2 Dodds Segregation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies