Top » Catalog » SNPs » FGC11759

$18.00

FGC11759
[FGC11759]

FGC11759
hg38 Position: ChrY:21137548..21137548
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: .
Forward Primer: FGC11759_F GATTTGTCCCAACTAACACTTAAGTG
Reverse Primer: FGC11759_R GTGGCTCACACTTGTAATCCC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC7936
FGC7936
ZS4755
ZS4755
FGC7
FGC7
FGC10095
FGC10095
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies