Top » Catalog » SNPs » FGC11759

$18.00

FGC11759
[FGC11759]

FGC11759
hg38 Position: ChrY:21137548..21137548
Ancestral: C
Derived: G
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: .
Forward Primer: FGC11759_F GATTTGTCCCAACTAACACTTAAGTG
Reverse Primer: FGC11759_R GTGGCTCACACTTGTAATCCC
Reviews

Customers who bought this product also purchased
FGC11745
FGC11745
FGC4316
FGC4316
FGC4314
FGC4314
ZS10722
ZS10722
FGC1707
FGC1707
FGC6
FGC6
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies