Top » Catalog » SNPs » A17731

$18.00

A17731
[A17731]

A17731
hg38 Position: ChrY:15866212..15866212
Ancestral: T
Derived: G
Reference: Anders Morup-Petersen (2017)
ISOGG Haplogroup: R1b
Comments: Below U152 > BY3604 > A15646
Forward Primer: A17731_F CTCTCCAGCCCACATTTCTC
Reverse Primer: A17731_R TTTCAGGGCATCAGAAAAGG
Reviews

Customers who bought this product also purchased
L22
L22
DNA Sample Kit
DNA Sample Kit
Y23687
Y23687
A17732
A17732
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies