Top » Catalog » SNPs » S659

$18.00

S659
[S659]

S659
hg38 Position: ChrY:12484132..12484132
Ancestral: G
Derived: A
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a
Comments: aka DF105. with S660
Forward Primer: DF105_F ACTTTCATTTCCCCAAAAGGAG
Reverse Primer: DF105_R AATTCCACTCCTAGGTATACACTCAAG
Reviews

Customers who bought this product also purchased
FGC59201
FGC59201
FGC42414
FGC42414
A10525
A10525
FGC19842
FGC19842
FGC30115
FGC30115
FGC19852
FGC19852
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies