Top » Catalog » SNPs » S659

$18.00

S659
[S659]

S659
hg38 Position: ChrY:12484132..12484132
Ancestral: G
Derived: A
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a
Comments: aka DF105. with S660
Forward Primer: DF105_F ACTTTCATTTCCCCAAAAGGAG
Reverse Primer: DF105_R AATTCCACTCCTAGGTATACACTCAAG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
BY21239
BY21239
FTA58716
FTA58716
Y178955
Y178955
BY132382
BY132382
A18723
A18723
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies