Top » Catalog » SNPs » S659

$18.00

S659
[S659]

S659
hg38 Position: ChrY:12484132..12484132
Ancestral: G
Derived: A
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a
Comments: aka DF105. with S660
Forward Primer: DF105_F ACTTTCATTTCCCCAAAAGGAG
Reverse Primer: DF105_R AATTCCACTCCTAGGTATACACTCAAG
Reviews

Customers who bought this product also purchased
A1774
A1774
FT410057
FT410057
BY35731
BY35731
BY81963
BY81963
FT252196
FT252196
BY35726
BY35726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies