Top » Catalog » SNPs » S659

$18.00

S659
[S659]

S659
hg38 Position: ChrY:12484132..12484132
Ancestral: G
Derived: A
Reference: Jim Wilson (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1a1a1a1a1a
Comments: aka DF105. with S660
Forward Primer: DF105_F ACTTTCATTTCCCCAAAAGGAG
Reverse Primer: DF105_R AATTCCACTCCTAGGTATACACTCAAG
Reviews

Customers who bought this product also purchased
A10535
A10535
BY13680
BY13680
FGC10138
FGC10138
FGC64966
FGC64966
A23675
A23675
A18726
A18726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies