Top » Catalog » SNPs » M1897

$18.00

M1897
[M1897]

M1897
hg38 Position: ChrY:19265313..19265313
Ancestral: C
Derived: T
Reference: Underhill et al.
ISOGG Haplogroup: N1b2
Comments: Below F2930 > F910.
Forward Primer: M1897_F AAGAAGACGCTTTCCTGCTG
Reverse Primer: M1897_R ATTTGTGATGGGCCAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies