Top » Catalog » SNPs » Z39534

$18.00

Z39534
[Z39534]

Z39534
hg38 Position: ChrY:2846786..2846786
Ancestral: T
Derived: C
Reference: ISOGG index (2017)
ISOGG Haplogroup: G
Comments: .
Forward Primer: Z39534_F CGGTTGTTTGGTTGTTTCTG
Reverse Primer: Z39534_R CAAGGATAAGGCCAATACCG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies