Top » Catalog » SNPs » BY21116

$18.00

BY21116
[BY21116]

BY21116
hg38 Position: ChrY:8703272..8703272
Ancestral: C
Derived: T
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below DF27 > BY653
Forward Primer: BY21116_F GACATTCAACATTAGCAACTCTCTG
Reverse Primer: BY21116_R GTGGCTTGGAGGAGAAGGTC
Reviews

Customers who bought this product also purchased
BY21118
BY21118
BY834
BY834
BY745
BY745
A4670
A4670
BY653
BY653
BY21141
BY21141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies