Top » Catalog » SNPs » BY21116

$18.00

BY21116
[BY21116]

BY21116
hg38 Position: ChrY:8703272..8703272
Ancestral: C
Derived: T
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below DF27 > BY653
Forward Primer: BY21116_F GACATTCAACATTAGCAACTCTCTG
Reverse Primer: BY21116_R GTGGCTTGGAGGAGAAGGTC
Reviews

Customers who bought this product also purchased
R1b-BY653 Panel
R1b-BY653 Panel
BY21120
BY21120
BY21118
BY21118
BY834
BY834
BY745
BY745
A4670
A4670
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies