Top » Catalog » SNPs » BY21120

$18.00

BY21120
[BY21120]

BY21120
hg38 Position: ChrY:2954646..2954646
Ancestral: A
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > BY653
Forward Primer: BY21120_F GTGGACAACCCAATGGAAAC
Reverse Primer: BY21120_R CTGCTGCTTCAGGAAACCAC
Reviews

Customers who bought this product also purchased
BY834
BY834
BY745
BY745
A4670
A4670
BY653
BY653
BY21141
BY21141
R1b-BY653 Panel
R1b-BY653 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies