Top » Catalog » SNPs » BY21141

$18.00

BY21141
[BY21141]

BY21141
hg38 Position: ChrY:18653273..18653273
Ancestral: C
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below DF27 > BY653
Forward Primer: BY21141v2_F ATCCTACTGCTCTTGGCTGG
Reverse Primer: BY21141v2_R ACCTCCACCTCCTGGGAC
Reviews

Customers who bought this product also purchased
R1b-BY653 Panel
R1b-BY653 Panel
BY21118
BY21118
BY21116
BY21116
BY834
BY834
BY745
BY745
A4670
A4670
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Z43407
1 x A27664
1 x A27435
$54.00
Haplogroup Info
Other products
Currencies