Top » Catalog » SNPs » BY745

$18.00

BY745
[BY745]

BY745
hg38 Position: ChrY:8069254..8069254
Ancestral: T
Derived: A
Reference: FTDNA (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > BY653
Forward Primer: BY745_F TGAGAAAAACTCAATGCTGTGC
Reverse Primer: BY745_R CCGGGGAGAAACTCTACAAAC
Reviews

Customers who bought this product also purchased
BY834
BY834
A4670
A4670
BY653
BY653
BY21141
BY21141
R1b-BY653 Panel
R1b-BY653 Panel
BY21120
BY21120
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies