Top » Catalog » SNPs » FGC35957

$18.00

FGC35957
[FGC35957]

FGC35957
hg38 Position: ChrY:13644327..13644327
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: I1a
Comments: Below DF29 > Y17611
Forward Primer: FGC35957_F ACTGATGGGGCAAACATCTC
Reverse Primer: FGC35957_R GAGCTTTTGCAAGGCAAGTG
Reviews

Customers who bought this product also purchased
S7660
S7660
FGC22115
FGC22115
FGC22112
FGC22112
A7626
A7626
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
FGC22113
FGC22113
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies