Top » Catalog » SNPs » FGC35955

$18.00

FGC35955
[FGC35955]

FGC35955
hg38 Position: ChrY:8882191..8882191
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: I1a1 (unlisted)
Comments: Below DF29 > Y17611
Forward Primer: FGC35955_F AGTTTTAATATTGTCTTACCTTTCGATG
Reverse Primer: FGC35955_R ATCTCAGTAACTGATGTAACTATCAGGAAAG
Reviews

Customers who bought this product also purchased
FGC14508
FGC14508
FGC23547
FGC23547
A7628
A7628
FGC14515
FGC14515
FGC43220
FGC43220
FGC17110
FGC17110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies