Top » Catalog » SNPs » FGC35958

$18.00

FGC35958
[FGC35958]

FGC35958
hg38 Position: ChrY:15297650..15297650
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: I1a
Comments: Below DF29 > Y17611
Forward Primer: FGC35958_F GCACCCCTGCAACAGTAAG
Reverse Primer: FGC35958_R TGGGGGCTTGTAGGACATAG
Reviews

Customers who bought this product also purchased
A7627
A7627
S7660
S7660
FGC22115
FGC22115
FGC22112
FGC22112
A7626
A7626
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies