Top » Catalog » SNPs » Y34377

$18.00

Y34377
[Y34377]

Y34377
hg38 Position: ChrY:19622787..19622787
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: I1a
Comments: Below DF29 > Y17611
Forward Primer: Y34377_F AGGTGGTAGCCTGGTAGTGG
Reverse Primer: Y34377_R TGTTTTCATGCTTCGTCTCG
Reviews

Customers who bought this product also purchased
FGC23547
FGC23547
A7628
A7628
FGC14515
FGC14515
FGC43220
FGC43220
FGC17110
FGC17110
A7627
A7627
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies