Top » Catalog » SNPs » Y34377

$18.00

Y34377
[Y34377]

Y34377
hg38 Position: ChrY:19622787..19622787
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: I1a
Comments: Below DF29 > Y17611
Forward Primer: Y34377_F AGGTGGTAGCCTGGTAGTGG
Reverse Primer: Y34377_R TGTTTTCATGCTTCGTCTCG
Reviews

Customers who bought this product also purchased
I1 VA-A THORNTON Family Panel v5
I1 VA-A THORNTON Family Panel v5
FGC22113
FGC22113
FGC23560
FGC23560
FGC23549
FGC23549
FGC22110
FGC22110
FGC23559
FGC23559
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies