Top » Catalog » SNPs » BY17956

$18.00

BY17956
[BY17956]

BY17956
hg38 Position: ChrY:6726576..6726576
Ancestral: A
Derived: G
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: BY17956_F GTGGCCTCAGAATACCAAATG
Reverse Primer: BY17956_R CCCATTTTATGTAGAACAGTCTGG
Reviews

Customers who bought this product also purchased
A10108
A10108
A10107
A10107
Wish a SNP
Wish a SNP
A10106
A10106
BY17966
BY17966
S7019
S7019
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies