Top » Catalog » SNPs » BY17958

$18.00

BY17958
[BY17958]

BY17958
hg38 Position: ChrY:7814082..7814082
Ancestral: G
Derived: A
Reference: FTDNA (2017)
ISOGG Haplogroup: R1b
Comments: Below Z18 > Z372 > S5970
Forward Primer: BY17958vl_F CAGGCAGATCACGATGTCAG
Reverse Primer: BY17958vl_R TGCCCGTAAATGGGATTAAG
Reviews

Customers who bought this product also purchased
Mail Tracking
Mail Tracking
FT54822
FT54822
FT53647
FT53647
FT54076
FT54076
FGC65842
FGC65842
FT53643
FT53643
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies