Top » Catalog » SNPs » A17887

$18.00

A17887
[A17887]

A17887
hg38 Position: ChrY:14921572..14921572
Ancestral: T
Derived: C
Reference: Oleg Sukhanov (2017)
ISOGG Haplogroup: N
Comments: Below Y28536
Forward Primer: A17887_F TTTAGGGATGAGGCGTTTTG
Reverse Primer: A17887_R TCTCTTTATACCTCTTTTCTCTTTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies