Top » Catalog » SNPs » A17273

$18.00

A17273
[A17273]

A17273
hg38 Position: ChrY:15483664..15483664
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2017)
ISOGG Haplogroup: I2
Comments: Below PF4088
Forward Primer: A17273_F GCCATGATTTCTTTAGTTGAATTCC
Reverse Primer: A17273_R CCCACATCTTATATTTCTTTTTCCC
Reviews

Customers who bought this product also purchased
HVR1
HVR1
PF4125
PF4125
PF4088
PF4088
A19300
A19300
L160
L160
Z27036
Z27036
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies