Top » Catalog » SNPs » Y17491

$18.00

Y17491
[Y17491]

Y17491
hg38 Position: ChrY:16092323..16092323
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: R1a1a1b1a (not listed)
Comments: Below Z282, peer to PF6155, Y2395, Z280.
Forward Primer: Y17491_F TGGAAGGGAAGGGCTAAAAC
Reverse Primer: Y17491_R GATTTGGCCTCCAGTAATCC
Reviews

Customers who bought this product also purchased
L260
L260
A19325
A19325
YP1341
YP1341
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
Y37285
Y37285
R1a-M458 Panel
R1a-M458 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies