Top » Catalog » SNPs » Y17491

$18.00

Y17491
[Y17491]

Y17491
hg38 Position: ChrY:16092323..16092323
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: R1a1a1b1a (not listed)
Comments: Below Z282, peer to PF6155, Y2395, Z280.
Forward Primer: Y17491_F TGGAAGGGAAGGGCTAAAAC
Reverse Primer: Y17491_R GATTTGGCCTCCAGTAATCC
Reviews

Customers who bought this product also purchased
L1029
L1029
YP5253
YP5253
YP258
YP258
Y166631
Y166631
BY30698
BY30698
L62
L62
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies