Top » Catalog » SNPs » Y17491

$18.00

Y17491
[Y17491]

Y17491
hg38 Position: ChrY:16092323..16092323
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: R1a1a1b1a (not listed)
Comments: Below Z282, peer to PF6155, Y2395, Z280.
Forward Primer: Y17491_F TGGAAGGGAAGGGCTAAAAC
Reverse Primer: Y17491_R GATTTGGCCTCCAGTAATCC
Reviews

Customers who bought this product also purchased
YP254
YP254
A19325
A19325
BY207879
BY207879
L145
L145
YP5248
YP5248
L260
L260
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies