Top » Catalog » SNPs » Y17491

$18.00

Y17491
[Y17491]

Y17491
hg38 Position: ChrY:16092323..16092323
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: R1a1a1b1a (not listed)
Comments: Below Z282, peer to PF6155, Y2395, Z280.
Forward Primer: Y17491_F TGGAAGGGAAGGGCTAAAAC
Reverse Primer: Y17491_R GATTTGGCCTCCAGTAATCC
Reviews

Customers who bought this product also purchased
BY30698
BY30698
L62
L62
YP1337
YP1337
Y132956
Y132956
Z93
Z93
YP254
YP254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies