Top » Catalog » SNPs » YP5190

$18.00

YP5190
[YP5190]

YP5190
hg38 Position: ChrY:21607933..21607933
Ancestral: G
Derived: A
Reference: YFull
ISOGG Haplogroup: R1a1a1a (not listed)
Comments: Below YP1014.
Forward Primer: YP5190_F GAAAAGAGATGACAAGACAATTTCG
Reverse Primer: YP5190_R CCTCTATCCAGAGTCCTGTGC
Reviews

Customers who bought this product also purchased
YP1014
YP1014
YP441
YP441
YP282
YP282
BY62687
BY62687
S2894
S2894
YP1224
YP1224
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies